ReferenceBases

Annotate with local reference bases (REF_BASES)

Category Variant Annotations

Overview

Local reference context at a variant position.

The annotation gives ten reference bases each to the left and right of the variant start and the start base for a total of 21 reference bases. Start position is defined as one base before indels. For example, the reference context AAAAAAAAAACTTTTTTTTTT would apply to a SNV variant context with ref allele C and alt allele G as well as to a deletion variant context with ref allele CT and alt allele C.

Return to top

GATK version 4.1.0.0 built at Wed, 30 Jan 2019 10:21:04 +0530.